View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_low_35 (Length: 229)
Name: NF20187_low_35
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_low_35 |
 | |
|
| [»] scaffold1301 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 17311063 - 17311261
Alignment:
| Q |
16 |
aggaggacaaagcttgatgtttcactcttggaaaatctcaagacagaactgctcagttttgaagttgtagttaatgatgacgctgttagtgtcaatgtat |
115 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
17311063 |
aggaggacgaagcttgatgtttcgctcttggaaaatctcaagacagaactgctcagttttgaagttgtagttaacgatgatgctgttagtgtcaatgtat |
17311162 |
T |
|
| Q |
116 |
ggttgaatatgctgagtgatgctgtttttcatgttgacatattgtttgatgaaatcaacactgaggcattgcgttgcaaagtggatgcagcgaatgaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17311163 |
ggttgaatatgctgagtgatgctgtttttcatgttgacatattatttgacgaaatcaacactgaggcattgcgttgcaaagtggatgcagcgaatgaaa |
17311261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1301 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 38 - 122
Target Start/End: Complemental strand, 481 - 397
Alignment:
| Q |
38 |
cactcttggaaaatctcaagacagaactgctcagttttgaagttgtagttaatgatgacgctgttagtgtcaatgtatggttgaa |
122 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||||||||||| ||||||||| |||||||| || ||||||||||||| |
|
|
| T |
481 |
cactcttggaaaagctccagacagaactgctcaattttgaagttgtacctaatgatgatgctgttagcgtacatgtatggttgaa |
397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 4141037 - 4141078
Alignment:
| Q |
157 |
ttgtttgatgaaatcaacactgaggcattgcgttgcaaagtg |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
4141037 |
ttgtttgacgaaatcaacactgaggcattgcggtgcaaagtg |
4141078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 4080871 - 4080828
Alignment:
| Q |
157 |
ttgtttgatgaaatcaacactgaggcattgcgttgcaaagtgga |
200 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4080871 |
ttgttagacgaaatcaacactgaggcattgcggtgcaaagtgga |
4080828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 200
Target Start/End: Complemental strand, 11498233 - 11498194
Alignment:
| Q |
161 |
ttgatgaaatcaacactgaggcattgcgttgcaaagtgga |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
11498233 |
ttgatgaaatcaacactgaggcgttgcgctgcaaagtgga |
11498194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University