View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_low_37 (Length: 214)
Name: NF20187_low_37
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 37134815 - 37135010
Alignment:
| Q |
1 |
tatttatgcattattgaattagtgcatcttagaaaggnnnnnnngagaggttattttgcctgttcttgacagtctactgagaactgaatttaatacatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134815 |
tatttatgcattattgaattagtgcatcttagaaaggaaaaaaagagaggttattttgcctgttcttgacagtctactgagaactgaatttaatacatca |
37134914 |
T |
 |
| Q |
101 |
agctgaatattgataacttcatttgaggttgtttctttcggacataatatcacacacagaaaaccgtttggaaagaatgcaatgaaagcatatcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134915 |
agctgaatattgataacttcatttgaggttgtttctttcggacataatatcacacacagaaaaccgtttggaaagaatgcaatgaaagcatatcaa |
37135010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University