View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20187_low_38 (Length: 211)
Name: NF20187_low_38
Description: NF20187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20187_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 36954596 - 36954697
Alignment:
| Q |
1 |
tcttttacttcccggtactgcaaggtgagtatcttctataacattagtttctcttgtcgctccctattacattaggaactaaagatcactaaactaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36954596 |
tcttttacttcccggtactgcaaggtgagtatcttctataacattagtttctcttgtcgctcgctattacattaggaactgaagatcactaaactaggat |
36954695 |
T |
 |
| Q |
101 |
tg |
102 |
Q |
| |
|
|| |
|
|
| T |
36954696 |
tg |
36954697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 36954732 - 36954790
Alignment:
| Q |
137 |
gaatgttcctcagattgccggtgcaattaggagtgaacatgccagctcaagctactagt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36954732 |
gaatgttcctcagattgccggtgcaattaggagtgaacatgccggctcaagctactagt |
36954790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University