View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20188_high_10 (Length: 256)
Name: NF20188_high_10
Description: NF20188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20188_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 5779079 - 5779307
Alignment:
| Q |
19 |
gatacgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcact---atgcttaacggctctgtggccgtcagca |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5779079 |
gatatgcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcactgtgatggttaacggctctgtggccgtcagca |
5779178 |
T |
 |
| Q |
116 |
acaacattgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtctacgctgtctccaaggtgttgatgccgaaagagcttcccgt |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5779179 |
acaacattgtccgagctcttgttactcggactttgtatgatcgctctccaatcgctgtctacgctgtctccaaggtgttgatgccgaaagagcttcccgc |
5779278 |
T |
 |
| Q |
216 |
gcccatcacctccgatgtcaccgccccta |
244 |
Q |
| |
|
|| ||||||||| |||||||||||||||| |
|
|
| T |
5779279 |
gctcatcacctctgatgtcaccgccccta |
5779307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 24 - 210
Target Start/End: Original strand, 5817359 - 5817548
Alignment:
| Q |
24 |
gcatttgcaagatacggtggcaaccgaaatcatgggccaggctacatataggataaacatcact---atgcttaacggctctgtggccgtcagcaacaac |
120 |
Q |
| |
|
||||||||||| | ||||||| | |||||||||| |||| || ||||| ||||||||||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
5817359 |
gcatttgcaagtcatggtggcagtcaaaatcatggggcaggataaatatatgataaacatcactgcaatggttaacggctctgtggccatcagcaacaac |
5817458 |
T |
 |
| Q |
121 |
attgtccgagctctcgttactcggactttgtatgatcgctctccagttgctgtctacgctgtctccaaggtgttgatgccgaaagagctt |
210 |
Q |
| |
|
||||| ||||||||||||||| |||| |||||||||||||||| |||| ||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
5817459 |
attgttcgagctctcgttacttggacattgtatgatcgctctctggttgttgtttacgccttctccaaggtgttgatgcccaaagagctt |
5817548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University