View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20188_low_10 (Length: 260)
Name: NF20188_low_10
Description: NF20188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20188_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 12321957 - 12322199
Alignment:
| Q |
1 |
atcaggttgttattggatgtgatgatgtgaattccaccattgcaaatatggttggactacacaaaacaaagctcttgcgtttctctacatgtgcagcccg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || || |
|
|
| T |
12321957 |
atcaggttgttattggatgtgatggtgtgaattccaccattgcaaatatggttggactacacgaaacaaagctcttgcgtttctctacatgtgctgctcg |
12322056 |
T |
|
| Q |
101 |
aggtttcacagagtatccaaatggtcatcaatttcctagtgagtttgctatgatgagcagaggtcaagtccagcttggattgatcccaataactgacaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||| |
|
|
| T |
12322057 |
aggtttcacagagtatccaaatggtcatcaatttcctagtgagtttgctatgatgagcagaggtcaagtccagcttggaatgatgccaatgactgacaag |
12322156 |
T |
|
| Q |
201 |
cttgtgtactggtttttaacaagagtcaacgctgctcaaggtc |
243 |
Q |
| |
|
||||| ||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
12322157 |
cttgtctactggtttgtaacaagactcaacactgctcaaggtc |
12322199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 4 - 246
Target Start/End: Original strand, 12314396 - 12314638
Alignment:
| Q |
4 |
aggttgttattggatgtgatgatgtgaattccaccattgcaaatatggttggactacacaaaacaaagctcttgcgtttctctacatgtgcagcccgagg |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||| | || ||||| |
|
|
| T |
12314396 |
aggttgttattggatgtgatggtgtgaattccaccattgcaaatatggttacactacaccaaacaaagctcttgcatttctctacatgcgttgctcgagg |
12314495 |
T |
|
| Q |
104 |
tttcacagagtatccaaatggtcatcaatttcctagtgagtttgctatgatgagcagaggtcaagtccagcttggattgatcccaataactgacaagctt |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
12314496 |
tttcacaaagtatccaaatggtcatcaatttcctaatgagtttgctatgataagcagaggtcaagtccagcttggaaggatcccaatgactgacaagctt |
12314595 |
T |
|
| Q |
204 |
gtgtactggtttttaacaagagtcaacgctgctcaaggtcatt |
246 |
Q |
| |
|
|| ||||||||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
12314596 |
gtttactggtttgtaacaaggctcaacactgctcaaggtcatt |
12314638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University