View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20188_low_14 (Length: 203)
Name: NF20188_low_14
Description: NF20188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20188_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 184
Target Start/End: Original strand, 32080796 - 32080960
Alignment:
| Q |
20 |
ctcctttctcagaagtgtcaatctttgattgtccaggtggaggcaaaagctcgaaattctgaaccagacgcccaatagtgataccaaggataggcaaggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32080796 |
ctcctttctcagaagtgtcaatctttgattgtccaggtggaggcaaaagctcgaaattctgaaccagacgcccaatagtgataccaaggataggcaaggc |
32080895 |
T |
|
| Q |
120 |
aagaataattccggggcaacttcttctaccaacaccgaaaggaagatacctaaaatcatttccat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32080896 |
aagaataattccggggcaacttcttctaccaacaccgaaaggaaggtacctaaaatcatttccat |
32080960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University