View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20188_low_5 (Length: 411)
Name: NF20188_low_5
Description: NF20188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20188_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 175 - 395
Target Start/End: Original strand, 41325455 - 41325676
Alignment:
| Q |
175 |
gcttcatgcagccatgcttcaaaaatgattagttagttttttgttgaagaatgcaagccaagtgatgaagctctgtaaataacagagacaatg-aatgac |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41325455 |
gcttcatgcagccatgcttcaaaaatgactagttagttttttgttgaagaatgcaagccaagtgatgaagctctgtaaataacagagacaatggaatgac |
41325554 |
T |
 |
| Q |
274 |
aaacattggctactatctttgattttatctgccctctcttcggaagtggtcttgatcttgagcatctgaacctgcagttcaagtttgcaatttctgaaga |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41325555 |
aaacattggctactatctttgattttatctgccctctcttcggaagtggtcttgatcttgagcatctgaacctgcagttcaagtttgcaatttctgaaga |
41325654 |
T |
 |
| Q |
374 |
ttcaaaatgatggacagtagtg |
395 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41325655 |
ttcaaaatgatggacagtagtg |
41325676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 10 - 137
Target Start/End: Original strand, 41325288 - 41325415
Alignment:
| Q |
10 |
gcacagagtaactcactaaataatattgtcatcaagctaggtctcatggtatttgatgattaaccaataaagatctcatgctcttgtaggctagcacaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41325288 |
gcacagagtaactcactaaataatattgtcatcaagctaggtctcatggtatttgatgattaaccaataaagatctcatgctctagtaggctagcacaag |
41325387 |
T |
 |
| Q |
110 |
tagatgaaagttacaagaataatgtaaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41325388 |
tagatgaaagttacaagaataatgtaaa |
41325415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University