View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20189_high_1 (Length: 389)
Name: NF20189_high_1
Description: NF20189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20189_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 32893661 - 32893836
Alignment:
| Q |
1 |
gggtaagtgtggcaggagagggacttaacatgaagaaaccgtgagttacaagcnnnnnnngttagaacttaatagcacaagctagatgaaacgtgagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32893661 |
gggtaagtgtggcaggagagggacttaacatgaagaaaccgtgagttacaagcaaaaaaagttagaacttaatagcacaagctagatgaaacgtgagatt |
32893760 |
T |
|
| Q |
101 |
gtttgtttaggtgatctttgatgaggagagtaaatcgtggggggaattttttgctttatttaggaactatatacatacat |
180 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32893761 |
gt----ttaggtgatctttgatgaggagagtaaatcgtggggggaattttttgctttatttaggaactatatacatacat |
32893836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 259 - 372
Target Start/End: Original strand, 32893928 - 32894041
Alignment:
| Q |
259 |
gggggtttggggaattgggcaatacaggaatggcccaatggtgggaatgagagagagatgggatggaggagaagacctcagcatgcagattgaagagatg |
358 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32893928 |
ggggttttggggaattgggcaatacaggaatggcccaatggtgggaatgagagagagatgggatggaggagaagacctcagcatgcagattgaagagatg |
32894027 |
T |
|
| Q |
359 |
atttgatttgatgt |
372 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32894028 |
atttgatttgatgt |
32894041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University