View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20189_low_8 (Length: 250)
Name: NF20189_low_8
Description: NF20189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20189_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 22792841 - 22793080
Alignment:
| Q |
1 |
ccgctgcagcacaacgagcagcggagtgggggttagtgttgaaaactgattcggagacggggaagccacaaggagtggcagttagaagctctggtggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22792841 |
ccgctgcagcacaacgagcagcagagtgggggttagtgttgaaaactgattcggagacggggaagccacaaggagtggcagttagaagctccggtggtgg |
22792940 |
T |
|
| Q |
101 |
ttcaaggagggactcgaacaattcaatgaaaagttccggtgaaagttccgatgacggaagggagtttagaggaatcccgagagtttcagaggatttgaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
22792941 |
ttcaaggagggactcgaacaattcaatgagaagttccggtgaaagttccgatgagggaagggagtttagaggaatcccaagagtttcggaggatttgaga |
22793040 |
T |
|
| Q |
201 |
gatgctctatcagcatttcaacagacatttgttgtctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22793041 |
gatgctctatcagcatttcaacagacatttgttgtttctg |
22793080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 40954528 - 40954574
Alignment:
| Q |
177 |
ccgagagtttcagaggatttgagagatgctctatcagcatttcaaca |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
40954528 |
ccgagagtttcagaggatttgaaagatgctttatcagcttttcaaca |
40954574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University