View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_28 (Length: 385)
Name: NF2018_high_28
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_28 |
 | |
|
| [»] scaffold0321 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0321 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: scaffold0321
Description:
Target: scaffold0321; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Original strand, 16219 - 16589
Alignment:
| Q |
1 |
agttcattcggaggtctgggttgggctgttttggtgattggtgtcattgcagcgttctttgtgggttactgctgcagaatccgccatagtggagtcgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16219 |
agttcattcggaggtctgggttgggctgttttggtgattggtgtcattgcagcgttctttgtgggttactgctgcagaatccgccatagtggagtcgaag |
16318 |
T |
|
| Q |
101 |
cagctgaagaagagtctattgatgaaaatgatttgacataggtggatgaagtatgattataccataggcatatgcatttttcatacacatgtatttttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16319 |
cagctgaagaagagtctattgatgaaaatgatttgacataggtggatgaagtatgattataccataggcatatgcatttttcatacacatgtatttttaa |
16418 |
T |
|
| Q |
201 |
ctagacattatcatgtgatcttccacgtcctatatctgtactgctcttcaacaatcatttattatcttgatggtttttcgaaccatctctttatatattt |
300 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16419 |
ctagacattatcatgtgatctttcacgtcctatatttgtactgctcttcaacaatcatttatctacttgatggtttttcgaaccatctctttatatattt |
16518 |
T |
|
| Q |
301 |
atagatattaatcatggttgcggtcacaaaaatttatataagcatttttgtattaaatacatttattgagta |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16519 |
atagatattaatcatggttgcggtcacaaaaatttatataagca-ttttgtattaaatacatttattgagta |
16589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University