View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_37 (Length: 346)
Name: NF2018_high_37
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 270
Target Start/End: Original strand, 2564008 - 2564270
Alignment:
| Q |
8 |
agattattctcggtatctgcatagcgcgtaacaatcatacatatctagtgtgtatatactctatatttgcactgcaagaggtgatagattttctctctaa |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564008 |
agattattctctgtatctgcatagcgcgtaagaatcatacatatctagtgtgtatatactctatatttgcactgcaagaggtgatagattttctctctaa |
2564107 |
T |
 |
| Q |
108 |
ttctaaagacacttgacgagctttggtttgaaaaatgaacaaattgtgggcaacacatgtatacctacctagtggttagttgcccagtcgagaaagatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564108 |
ttctaaagacacttgacgagctttggtttgaaaaatgaacaaattgtgggcaacacatgtatacctacctagtggttagttgcccagtcgagaaagatat |
2564207 |
T |
 |
| Q |
208 |
atcttttcttgggaccacgggcaatgatttgtgaggctagtgcacaatgcacatgggtttgta |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2564208 |
atcttttcttgggaccacgggcaatgatttgtgaggctagtgcacaatgcacatgggtttgta |
2564270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University