View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_39 (Length: 345)
Name: NF2018_high_39
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 331
Target Start/End: Complemental strand, 14126902 - 14126587
Alignment:
| Q |
16 |
atgtgctaaacatcttttcaattccatttattagagaattcggtagagcaagaaggtactgatcaaataagagggaatagattatagtgccaactttatc |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14126902 |
atgtgttaaacatcttttcaattccatttattagagaattcagtagagcaagaaggtactgatcaaataagagggaatagattatagtgccaactttatc |
14126803 |
T |
 |
| Q |
116 |
agtacctctcatcctgcttacgagagacagtagctgctccatgaattaattttgttccaaatccgatcttttctgccgcagaatgtctctgacttttgaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14126802 |
ggtacctctcatcctgcttacgagagacagtagctgctccatgaattaattttgttccaaatccgatcttttctgctgcagaatgtctctgacttttgaa |
14126703 |
T |
 |
| Q |
216 |
aattaatagcttgaccagatgtcgcttcgtatgaggctaggatatttttcatgacattttcttcactagcagagcttttgaagaacaaaaaacagtcatc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14126702 |
aattaatagcttgaccagatgtcgcttcgtatgaggctaggatatttttcatgacattttcttcactagcagagcctttgaagaacaaaaaacagtcatc |
14126603 |
T |
 |
| Q |
316 |
agcaaggagtaggtga |
331 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
14126602 |
agcaaagagtaggtga |
14126587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University