View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_53 (Length: 293)
Name: NF2018_high_53
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 173 - 283
Target Start/End: Complemental strand, 7323098 - 7322988
Alignment:
| Q |
173 |
cattcctttaaggtctatagctggctgttttactgatttcataaagatattacagtgattcttaccaaaactgttctgggaaagcacttccttcttttaa |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7323098 |
cattcctttaaggtctatagctggctgttttactgatttcataaagatattacagtgattcttaccaaaactgttccgggaaagcacttccttcttttaa |
7322999 |
T |
|
| Q |
273 |
catgtcctttg |
283 |
Q |
| |
|
||||||||||| |
|
|
| T |
7322998 |
catgtcctttg |
7322988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 40 - 110
Target Start/End: Complemental strand, 7323232 - 7323162
Alignment:
| Q |
40 |
ttagttttaccttgccttaatgtacaactgttggtatattacttaagctttaggtacaattcatctttgcc |
110 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7323232 |
ttagttttaccttgccttaatgtagaactgttggtatattacttaagctttaggtacaattcatctttgcc |
7323162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 64
Target Start/End: Original strand, 7244996 - 7245024
Alignment:
| Q |
36 |
atgattagttttaccttgccttaatgtac |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7244996 |
atgattagttttaccttgccttaatgtac |
7245024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University