View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_58 (Length: 270)
Name: NF2018_high_58
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 105 - 256
Target Start/End: Complemental strand, 3310615 - 3310465
Alignment:
| Q |
105 |
gagcatatatctgctgttttttctctcctccttttggctatatgtttccatgatgttttattccattaacaggtatgcctcctttcctcagatctgattc |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310615 |
gagcatatatctgctgttttt-ctctcctccttttggctatatgtttccatgatgttttattccattaacaggtatgcctcctttcctcagatctgattc |
3310517 |
T |
 |
| Q |
205 |
agttattagtatttttcccttttacatttctgaaatcttcttttgaattatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310516 |
agttattagtatttttcccttttacatttctgaaatcttcttttgaattatt |
3310465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University