View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_68 (Length: 249)
Name: NF2018_high_68
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 39029010 - 39029244
Alignment:
| Q |
1 |
caggaataagcttaataacgtggaacaatctactaccatgaaatggttttgatatcacaatatcatcttgatcaattgcttggtaatcaacactactctc |
100 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39029010 |
caggaagaagcttaataacttggaacaatctactaccatgaaatggttttgatatcacattatcatcttgatcaattgcttggtaatcaacactactctc |
39029109 |
T |
 |
| Q |
101 |
aaaaggcttttccaaccaaacaactttactaggattgagaagatctttcttgaagtttgacacaatcttacaaagcttagaaaatggtcctgcatttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39029110 |
aaaaggcttttccaaccaaacaactttactaggattgagaagatctttcttgaagtttgacacaatcttacaaagcttagaaaatggtcctgcatttgca |
39029209 |
T |
 |
| Q |
201 |
tcaatgataatcaaaataaaacttggtgcagctcc |
235 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| |
|
|
| T |
39029210 |
tcaatgataatcagaacaaaacttggtgcagctcc |
39029244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 77
Target Start/End: Original strand, 40896046 - 40896102
Alignment:
| Q |
21 |
tggaacaatctactaccatgaaatggttttgatatcacaatatcatcttgatcaatt |
77 |
Q |
| |
|
|||||||| | |||||| ||||||||||| ||||| ||||| |||| |||||||||| |
|
|
| T |
40896046 |
tggaacaaacgactaccgtgaaatggtttcgatatgacaatgtcattttgatcaatt |
40896102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University