View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_high_73 (Length: 238)
Name: NF2018_high_73
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_high_73 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 50 - 224
Target Start/End: Original strand, 31890003 - 31890177
Alignment:
| Q |
50 |
tatatatacacatgtcttgataattgttttttaagaaaaacatcaagaagaaacatgaatttcaagctttaaaacattcctcacttcatcaatatccatt |
149 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31890003 |
tatataaatacatgtcttgataattgttttttaagaaaaacatcaagaagaaacatgaatttcaagctttaaaacattcctcacttcatcaatatccatt |
31890102 |
T |
|
| Q |
150 |
gctaactcaactcattggttattagggaattgaaagacaaattaagaaaacatggaagcagtatgatgaattgtt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31890103 |
gctaactcaactcattggttattagggaattgaaagacaaattaagaaaacatggaagcagtatgatgaattgtt |
31890177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31889914 - 31889962
Alignment:
| Q |
1 |
atgacttttaactaataaaagaaagtatgtcgttaacactcgtctacgc |
49 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31889914 |
atgacttttaactaataaaataaagtatgtcgttaacactcgtctacgc |
31889962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University