View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_low_30 (Length: 374)
Name: NF2018_low_30
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_low_30 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 14 - 374
Target Start/End: Complemental strand, 41533863 - 41533503
Alignment:
| Q |
14 |
tctttttcttataaccctcttgtctcttctattaaattatcatctcaaaattcgaacttgctttcaacttcatcgattgctctgtttcttcaaaactcaa |
113 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41533863 |
tctttttcttataacccttttgtctcttctattaaattatcatctcaaaattcgaacttgctttcaacttcatcgattgctctgtttcttcaaaactcaa |
41533764 |
T |
 |
| Q |
114 |
tttgcaattagggtttatgaggtttgtgttgtttttgagcttggaagtttaaatttcgtttctggggttgtttaacttttgattttaacacgacccgtta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41533763 |
tttgcaattagggtttatgaggtttgtgttgtttttgagcttggaagtttaaatttcgtttctggggttgtttaacttttgattttaacacgacccgtta |
41533664 |
T |
 |
| Q |
214 |
cttcaatttttgtttttgaagaaggaatgattattaagaggaacttgaaatctcaaatgccgagtttgaaacggtgtaaactcgctgactcagttggtga |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41533663 |
cttcaatttttgtttttgaagaaggaatgattattaagaggaacttgaaatctcaaatgccgagtttgaaacggtgtaaactcgctgactcagttggtga |
41533564 |
T |
 |
| Q |
314 |
tgatgaagagtgttcttatgctcgtaagaagnnnnnnnctaacggttattattatcctttg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41533563 |
tgatgaagagtgttcttatgctcgtaagaagaaaaaaactaacggttattattatcctttg |
41533503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University