View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2018_low_55 (Length: 293)

Name: NF2018_low_55
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2018_low_55
NF2018_low_55
[»] chr4 (3 HSPs)
chr4 (173-283)||(7322988-7323098)
chr4 (40-110)||(7323162-7323232)
chr4 (36-64)||(7244996-7245024)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 173 - 283
Target Start/End: Complemental strand, 7323098 - 7322988
Alignment:
173 cattcctttaaggtctatagctggctgttttactgatttcataaagatattacagtgattcttaccaaaactgttctgggaaagcacttccttcttttaa 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
7323098 cattcctttaaggtctatagctggctgttttactgatttcataaagatattacagtgattcttaccaaaactgttccgggaaagcacttccttcttttaa 7322999  T
273 catgtcctttg 283  Q
    |||||||||||    
7322998 catgtcctttg 7322988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 40 - 110
Target Start/End: Complemental strand, 7323232 - 7323162
Alignment:
40 ttagttttaccttgccttaatgtacaactgttggtatattacttaagctttaggtacaattcatctttgcc 110  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
7323232 ttagttttaccttgccttaatgtagaactgttggtatattacttaagctttaggtacaattcatctttgcc 7323162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 64
Target Start/End: Original strand, 7244996 - 7245024
Alignment:
36 atgattagttttaccttgccttaatgtac 64  Q
    |||||||||||||||||||||||||||||    
7244996 atgattagttttaccttgccttaatgtac 7245024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University