View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_low_61 (Length: 269)
Name: NF2018_low_61
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 14355597 - 14355724
Alignment:
| Q |
1 |
gttcccataccaattcttgatatatctaacatggatatatccgattttgatgaagaggaagaatatgttattcatgttgactgtaatttaggttatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14355597 |
gttcccataccaattcttgatatatctaacatggatatatccgattttgatgaagaggaagaatatgttattcatgttgactgtaatttaggttatgcat |
14355696 |
T |
|
| Q |
101 |
cctctttagaacctgaactagatatacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14355697 |
cctctttagaacctgaactagatatacc |
14355724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 125 - 260
Target Start/End: Original strand, 14355757 - 14355905
Alignment:
| Q |
125 |
taccttcaatccatgcatctcaa-ccatcaatgttccaccaccgcctacccttttactggattctattgtattgagagaggtt------------tttga |
211 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14355757 |
taccttcaatccatgcacctcaaaccatcaatgttccaccaccgcctacccttttactggattctattgtattgagagaggtttttgagaacatatttga |
14355856 |
T |
|
| Q |
212 |
gaacatatttgacccttttagaaatgatctagttcacattgagaattat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14355857 |
gaacatatttgacccttttagaaatgatctagttcacattgagaattat |
14355905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 81
Target Start/End: Original strand, 10331351 - 10331423
Alignment:
| Q |
9 |
accaattcttgatatatctaacatggatatatccgattttgatgaagaggaagaatatgttattcatgttgac |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||| || || ||| |||||| |||| ||||| |
|
|
| T |
10331351 |
accaattcttgatatatctaacatggatatattagattctgatgaggaagatgaacatgttactcatattgac |
10331423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 170 - 223
Target Start/End: Complemental strand, 22536339 - 22536286
Alignment:
| Q |
170 |
tacccttttactggattctattgtattgagagaggtttttgagaacatatttga |
223 |
Q |
| |
|
|||||||||||| ||||||||| |||| | |||||| | ||||||||||||||| |
|
|
| T |
22536339 |
tacccttttactagattctattatattaaaagaggtatgtgagaacatatttga |
22536286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University