View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_low_62 (Length: 267)
Name: NF2018_low_62
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 32 - 248
Target Start/End: Complemental strand, 5103415 - 5103199
Alignment:
| Q |
32 |
ggaggatcatcaaccagtggatgagcgacacgtggtggttgtggctgaaacgagtgtaaccgtttctaggtctaatccggttgatcgaactcgcgatgac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5103415 |
ggaggatcatcaaccagtggatgagcgacacgtggtggttgtggctgaaacgagtgtaaccgtttctaggtctaatccgtttgatcgaactcgcgatgac |
5103316 |
T |
 |
| Q |
132 |
tcggtagataaccgtcgtgtggtgcatgttgctgttgcaaatgaagacggcgggaaatcggtgactgaagctggaagtgctgatgatcgtaatcgccgcg |
231 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5103315 |
tcggtggataaccgtcgtgtggtggatgttgctgttgcaaatgaagacggcgggaaatcggtgaccgaagctggaagtgctgatgatcgtaatcgccgcg |
5103216 |
T |
 |
| Q |
232 |
gaaatcgtggtgactcg |
248 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5103215 |
gaaatcgtggtgactcg |
5103199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University