View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_low_73 (Length: 248)
Name: NF2018_low_73
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 10028439 - 10028279
Alignment:
| Q |
1 |
aacaaaataccatggccaacaagccctatacagggaattagaaagatgtgtgaatcaa--ccggagttggacagcattcttgaaaatcatggaaagaagc |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||||||| |||| | ||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
10028439 |
aacaaaataccatggctaacaagccctatacatggaattagggagatgtgtgagtcaatactggaattggacaacattcttgaaaatcatggaaagaagc |
10028340 |
T |
|
| Q |
99 |
aaccattgatcatgggaacatttcattgaagattcaagatcatcaagtgacaccctctactaa |
161 |
Q |
| |
|
||||||| || || |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10028339 |
aaccattaatg--ggaaacatttccttgaagattcaagatcatcaagtgacaccctctactaa |
10028279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 232
Target Start/End: Complemental strand, 10028187 - 10028155
Alignment:
| Q |
200 |
agggggaataatcatgagattgttggtaatttg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10028187 |
agggggaataatcatgagattgttggtaatttg |
10028155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University