View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_low_77 (Length: 239)
Name: NF2018_low_77
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_low_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 3843792 - 3843591
Alignment:
| Q |
20 |
aagtaatgtgcttttggcaacaattgaaaatatgcagtatgctgtacccctagatgttcttcactcggtgagaattttatttctcattaaaagggtaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843792 |
aagtaatgtgcttttggcaacaattgaaaatatgcagtatgctgtacccctagatgttcttcactcggtgagaattttatttctcattaaaagggtaatt |
3843693 |
T |
|
| Q |
120 |
tattggtgatttatatttaatacttctgacatgcatttacaggtgttttctgcatttggctttgttcagaaagttgctatgtttgataagcatgggcaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3843692 |
tattggtgatttatatttaatacttctgacatgcatttacaggtgttttctgcatttggctttgttcagaaagttgctatgtttgataagaatgggcaca |
3843593 |
T |
|
| Q |
220 |
ct |
221 |
Q |
| |
|
|| |
|
|
| T |
3843592 |
ct |
3843591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University