View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2018_low_86 (Length: 218)
Name: NF2018_low_86
Description: NF2018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2018_low_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 29097648 - 29097827
Alignment:
| Q |
18 |
atgaaattcaactctatatttctgtcacgaaatttaataacataactaaatagaaatttgacgtttttcctctctaaattttgttctttgataaagttct |
117 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29097648 |
atgaaattcaactctatttttttgtcaagaaatttaataacataactaaatagaaatttgacgtttttcctctctaaattttgttctttgataaagtcct |
29097747 |
T |
|
| Q |
118 |
gtctttttaaaagtctgatataagttattagtttaaaggcatatttctaatataaatgtctttaaatatggatgatcaca |
197 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29097748 |
atctttttaaaagtctgatataaattgttagtttaaaggcatatttctaatataaatgtctttaaatatggatgatcaca |
29097827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University