View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20190_low_7 (Length: 295)
Name: NF20190_low_7
Description: NF20190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20190_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 2 - 288
Target Start/End: Complemental strand, 26283108 - 26282822
Alignment:
| Q |
2 |
gtcaaaatacttgtcttcattggaggaggtggtggtggtgcttgactcttcctagctggtattggaggaggtgcaggtggtgctgcagctgctgaaattg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26283108 |
gtcaaaatacttgtcttcattggaggaggtggtggtggtgcctgactcttcctagctggtattggaggaggtgcaggtggtgctgcagctgctgaaattg |
26283009 |
T |
|
| Q |
102 |
atggtagaatggatggttgagattgaaagccttgtttctgaacaccatcgtttgtggatggttgagattgaattcttggaattctatatagatcatcctc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26283008 |
atggtagaatggatggttgagattgaaagccttgtttctgaacaccatcatttgtggatggttgagattgaattcttggaattctatatagatcatcctc |
26282909 |
T |
|
| Q |
202 |
ttcttgaaatatgtgtgaagctgaagattttcctctaagaagaggtatttcttgaatggacttagattttttcacttgatattcttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26282908 |
ttcttgaaatatgtgtgaagctgaagattttcctctaagaagaggtatttcttgaatggacttagattttttcacttgattttcttc |
26282822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University