View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20191_high_1_N (Length: 398)
Name: NF20191_high_1_N
Description: NF20191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20191_high_1_N |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 25 - 265
Target Start/End: Complemental strand, 34697312 - 34697071
Alignment:
| Q |
25 |
catcaaccaaatgaagccatgaacattgcacacgtccatgagatattatataacataaccataccccgtgcgt-acattctgggtgtgcgcacacgcgcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | | ||||||||||||||||| ||||| |
|
|
| T |
34697312 |
catcaaccaaatgaagccatgaacattgcacacgtccatgagatattatagaacataaccataccccgtgctttaaattctgggtgtgcgcacgggcgcc |
34697213 |
T |
 |
| Q |
124 |
cacacaaacacatgtaaatattgatatatattatgtccaaaccttctgttttttaagaagggactataggaaatttagagtttgacacataagtaaagtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34697212 |
cacacaaacacatgtaaatattgatatatattttgtccaaaccttctgttttttaagaagggactataggtaatttagagtttgacacataagtaaagtt |
34697113 |
T |
 |
| Q |
224 |
tgatnnnnnnnttgttcaaactaggatttaaatcagtttgtt |
265 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
34697112 |
tgataaaaaaattgttaaaactaggatttaaatcagtttgtt |
34697071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 263 - 370
Target Start/End: Complemental strand, 34695344 - 34695237
Alignment:
| Q |
263 |
gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaatgaatatttattaccttgaaattgatcaccagtaaag |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34695344 |
gttttcaaatattcatctttaattgaaattatttaccacttaagttcaatcactttataaaaattaatatttattaccttgaaattgatcaccagtaaag |
34695245 |
T |
 |
| Q |
363 |
aggaatgg |
370 |
Q |
| |
|
|||||||| |
|
|
| T |
34695244 |
aggaatgg |
34695237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University