View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20192_high_3 (Length: 481)
Name: NF20192_high_3
Description: NF20192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20192_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 439; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 439; E-Value: 0
Query Start/End: Original strand, 1 - 471
Target Start/End: Original strand, 52785393 - 52785863
Alignment:
| Q |
1 |
agttttccggtgggctaggagttacggttgtgggggctggaggtgggctttgggatggaagatcaggtgaggtgtaaggaggtgatggttgggtaggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785393 |
agttttccggtgggctaggagttacggttgtggggcctggaggtgggctttgggatggaagatcaggtgaggtgtaaggaggtgatggttgggtaggttg |
52785492 |
T |
 |
| Q |
101 |
tgagcttgtgggtgttggaatagtggtagaaggagtactgctacttggtggtgggtatacacaatatggagggctttttcctggagctagtgattcataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785493 |
tgagcttgtgggtgttggaatagtggtagaaggagtactgctacttggtggtgggtatacacaatatggagggctttttcctggagctagtgattcataa |
52785592 |
T |
 |
| Q |
201 |
ggaggcaaagataatggagagctaataccagaggattgtgcatttgatgaatatatagatggatcaaaatcaaaatgcttcattattttcaacttctttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785593 |
ggaggcaaagataatggagagctaataccatagggttgtgcatttgatgaatatatagatggatcaaaatcaaaatgcttcattattttcaacttctttg |
52785692 |
T |
 |
| Q |
301 |
ggttcttgttgattacaattcttctgtgtttaggggctttcaatagtcttattgatctatttgcatctgcaaagttgaaagtaagaggtttttgagttgt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||||| ||||||||| | |
|
|
| T |
52785693 |
ggttcttgttgattacaattcttctgtgtttaggggctttcaacagccttattgatctatttgcatctgcaaagtggaaagtaagaggcttttgagttct |
52785792 |
T |
 |
| Q |
401 |
gaactcactatcgtatcaaatttatttgatctcaataacataatgcagttgcaactatattttggtgccct |
471 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785793 |
gaactcactatcgtatcaaatttatttgatctcaataacataatgcagttgcaactatattttggtgccct |
52785863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University