View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20192_low_16 (Length: 219)
Name: NF20192_low_16
Description: NF20192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20192_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 5052180 - 5052371
Alignment:
| Q |
1 |
caatagtaccttggtttcaaatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgttttgcattgacttaactagtcaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5052180 |
caatagtaccttggtttcagatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgctttgcattgacttaactagtcaa |
5052279 |
T |
|
| Q |
101 |
tgttnnnnnnnttgattataatatacaatatggatttcaaatatagcagttaatatcaaatttgcacggtgatataacagggatgcccttca |
192 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5052280 |
tgttaaaaaatttgattataatatacaatatggctttcaaatatagtagttaatatcaaatttgcacggtgctataacagggatgcccttca |
5052371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 5048194 - 5048273
Alignment:
| Q |
6 |
gtaccttggtttcaaatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgttttgcatt |
85 |
Q |
| |
|
||||||| ||||||||||||| | || |||| | | ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5048194 |
gtaccttagtttcaaatgtttgactgttctgacttggtcatgatctcatcaaatttggatatgttttaatgctttgcatt |
5048273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 205
Target Start/End: Original strand, 5048513 - 5048569
Alignment:
| Q |
148 |
agttaatatcaaatttgcacggtgatataacagggatgcccttcacttctgtgatgtg |
205 |
Q |
| |
|
||||||||||||||||||||||| || || ||||||||||||||||| ||||||||| |
|
|
| T |
5048513 |
agttaatatcaaatttgcacggtccta-aatagggatgcccttcacttttgtgatgtg |
5048569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University