View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20192_low_16 (Length: 219)

Name: NF20192_low_16
Description: NF20192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20192_low_16
NF20192_low_16
[»] chr1 (3 HSPs)
chr1 (1-192)||(5052180-5052371)
chr1 (6-85)||(5048194-5048273)
chr1 (148-205)||(5048513-5048569)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 5052180 - 5052371
Alignment:
1 caatagtaccttggtttcaaatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgttttgcattgacttaactagtcaa 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
5052180 caatagtaccttggtttcagatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgctttgcattgacttaactagtcaa 5052279  T
101 tgttnnnnnnnttgattataatatacaatatggatttcaaatatagcagttaatatcaaatttgcacggtgatataacagggatgcccttca 192  Q
    ||||       |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
5052280 tgttaaaaaatttgattataatatacaatatggctttcaaatatagtagttaatatcaaatttgcacggtgctataacagggatgcccttca 5052371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 5048194 - 5048273
Alignment:
6 gtaccttggtttcaaatgttttatggtcatgacgtaggcatgatctcatcaaatttggatatgttttaatgttttgcatt 85  Q
    ||||||| ||||||||||||| |  ||  |||| | | ||||||||||||||||||||||||||||||||| ||||||||    
5048194 gtaccttagtttcaaatgtttgactgttctgacttggtcatgatctcatcaaatttggatatgttttaatgctttgcatt 5048273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 205
Target Start/End: Original strand, 5048513 - 5048569
Alignment:
148 agttaatatcaaatttgcacggtgatataacagggatgcccttcacttctgtgatgtg 205  Q
    |||||||||||||||||||||||  || || ||||||||||||||||| |||||||||    
5048513 agttaatatcaaatttgcacggtccta-aatagggatgcccttcacttttgtgatgtg 5048569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University