View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20192_low_17 (Length: 215)
Name: NF20192_low_17
Description: NF20192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20192_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 25306719 - 25306530
Alignment:
| Q |
18 |
tcttcaagacactaaccactccaacatgnnnnnnnnccttggattttccttttatcaagataattgatagatgcaaattctcatcttttacttcacgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
25306719 |
tcttcaagacactaaccactccaacatgttttttttccttggattttccttttatcaagataatttatagatgcaaattctcatcttttacttcacggtg |
25306620 |
T |
|
| Q |
118 |
ttcacatgtagcatcaatatgttctctacgggtactatattttgttaacaaatctattatccacatcacaacaaatcacatattcttcga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
25306619 |
ttcacatgtagcatcaatatgttctctacgggtactatattttgttaacaaatctattatccacatcacaacaaatcacatctttttcga |
25306530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 64 - 190
Target Start/End: Complemental strand, 25277996 - 25277867
Alignment:
| Q |
64 |
tccttttatcaagataattgata--gatgcaaattctcatctttt-acttcacgatgttcacatgtagcatcaatatgttctctacgggtactatatttt |
160 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| |||||||| ||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25277996 |
tccttttatcaagataatttatatagatgcaaattctcatctttttacttcacgttgttcacatttagcatccatatgttctctacgggtactatatttt |
25277897 |
T |
|
| Q |
161 |
gttaacaaatctattatccacatcacaaca |
190 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |
|
|
| T |
25277896 |
gttaaaaaatctataatccacatcacaaca |
25277867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University