View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20193_low_11 (Length: 346)
Name: NF20193_low_11
Description: NF20193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20193_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 16 - 328
Target Start/End: Original strand, 38890708 - 38891020
Alignment:
| Q |
16 |
atcaaacggaggattcaccgcgttaatctgatccttattattccaatacaaaatcgagtatttcagattcttcttcagaacgggtttattcgatttgaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38890708 |
atcaaacggaggattcaccgcgttaatctgatccttattattccaatacaaaatcgagtatttcagattcttcttcagaacgggtttattcgatttgaga |
38890807 |
T |
 |
| Q |
116 |
ttcttcttgagtgcgggcataaccggagggatatcggtgaggatgatgtcggtgagtccgagaaggtagagacccatgccggcgacgccgcaaccgcagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38890808 |
ttcttcttgagtgcgggcataaccggagggatatcggtgaggatgatgtcggtgagtccgagaaggtagagacccatgccagcgacgccgcaaccgcagc |
38890907 |
T |
 |
| Q |
216 |
cgagttcgatggcgcgtttggattggaagttgaggaggtgggtgtaggggttggtggtgttgggtggagtgtggatccagcggtcgatgaatttgaccag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38890908 |
cgagttcgatggcgcgtttggattggaagttgaggaggtgggtgtaggggttggtggtgttgggtggagtgtggatccagcggtcgatgaatttgaccag |
38891007 |
T |
 |
| Q |
316 |
gacgagggagcag |
328 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38891008 |
gacgagggagcag |
38891020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University