View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20193_low_13 (Length: 321)
Name: NF20193_low_13
Description: NF20193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20193_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 305
Target Start/End: Complemental strand, 10014459 - 10014168
Alignment:
| Q |
13 |
aatatgatttaccgtgactaacacactacaagagaaaagattatcttcggccattatcttccgagggattttggttatttccaagggtttttgtccctag |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10014459 |
aatatgatttaccgtgactaacgcactacaagagaaaagattatcttcggccatt-tcttccgagggattttggttatttccaagggtttttgtccctag |
10014361 |
T |
 |
| Q |
113 |
ggaaccaatgatttacttgtagtggtggtgtctaggtagagaatagatagtaaagactatttataatgtgacaaaacttgggaaattaactattagtttt |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10014360 |
gaaaccaatgatttacttgtagtggtggtgtctaggtagagaatagatagtaaagactatttataatgtgacaaaacttgggaaattaactattagtttt |
10014261 |
T |
 |
| Q |
213 |
aggggataacnnnnnnnnnnnnnnnnctgtgctttaacaggaagttggatcaaaagtattgtttccaaggcaaatatatagagtaatgtatat |
305 |
Q |
| |
|
||||||| || || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10014260 |
aggggatgacaaaagaaaaaagaaaactttgctttagcaggaagttggatcaaaagtattgtttccaaggcaaatatatagagtaatgtatat |
10014168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University