View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_high_27 (Length: 294)
Name: NF20194_high_27
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_high_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 47728826 - 47729101
Alignment:
| Q |
1 |
attacccagtcatgacaagagaggagaaaatggtcagcaccattgcttctattccaataaggatacttatgagccacaacatttacataatcctccacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47728826 |
attacccagtcatgacaagagaggagaaaatggtcagcaccattgcttctattccaataaggatacttatgagccacaacatttacataatcctccacca |
47728925 |
T |
|
| Q |
101 |
ttctatgaagtctgtcacggttgaaatcctttttggacataattggcttataaacatattgaaccacatttgcaacactaaaaggaaggaaaaatatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47728926 |
ttctatgaagtctgtcacggttgaaatcctttttggacataattggcttataaacatattgaaccacatttgcaacactaaaaggaaggaaaaatatgtg |
47729025 |
T |
|
| Q |
201 |
tgcctcgttagggtgcttagccttaaaaggactcattttgctattgtctatttcatcaatgaattgaccttcaatt |
276 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729026 |
tgcctcattagggtgcttagccttaaaaggactcattttgctattgtctatttcatcaatgaattgaccttcaatt |
47729101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 3 - 68
Target Start/End: Original strand, 263535 - 263600
Alignment:
| Q |
3 |
tacccagtcatgacaagagaggagaaaatggtcagcaccattgcttctattccaataaggatactt |
68 |
Q |
| |
|
|||||| ||||| || || || ||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
263535 |
tacccaatcatggcatgaaagtagaaaatggtcagcaccttggcttctgttccaataaggatactt |
263600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University