View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_high_29 (Length: 279)
Name: NF20194_high_29
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 112 - 260
Target Start/End: Original strand, 8932504 - 8932656
Alignment:
| Q |
112 |
gcaaaattaatctgt-aattttgagttgttggaattatcatacaatcaaggataaactcttccacttctaagtggcattgatcttt-attggac--tatg |
207 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
8932504 |
gcaaaattaatctgttaattttaagttgtaagaagtatcatacaatcaaggataaactcttccacttctaagtgtcattgatctttcattggactatatg |
8932603 |
T |
|
| Q |
208 |
agtcccatgtctaattaataggtgatgctgttgtggacaaattaattttgtaa |
260 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8932604 |
agtcccatgtctaattaataggtgacactattgtggacaaattaattttgtaa |
8932656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University