View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_high_37 (Length: 240)
Name: NF20194_high_37
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 56 - 209
Target Start/End: Complemental strand, 3029326 - 3029175
Alignment:
| Q |
56 |
tcatcaaaactaaagtattactttctcctgcatttgttatcaccaacatatagggtataaaaagagcatcactgtaaggattttgatcaagataatttaa |
155 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||||| ||||| |||||||||||||||| |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
3029326 |
tcatcaaaacta--gtactactttcccctgcatttgttataaccaaaatatagggtataaaaacagcatctctgtaagggttttgatcaagataatttaa |
3029229 |
T |
 |
| Q |
156 |
taacaaaatagagttttaagaagcagatgatggtggttgttgattattccttag |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3029228 |
taacaaaatcgagttttaagaagcagatgatggtggttgttgattattccttag |
3029175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 110 - 200
Target Start/End: Original strand, 26353437 - 26353527
Alignment:
| Q |
110 |
gtataaaaagagcatcactgtaaggattttgatcaagataatttaataacaaaatagagttttaagaagcagatgatggtggttgttgatt |
200 |
Q |
| |
|
|||| |||||||||||||||| || ||| || ||| |||| || ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26353437 |
gtatgaaaagagcatcactgtcgtgagtttcatgaagggaattcaaaaacaaaataaagttttaagaagaagatgatggtggttgttgatt |
26353527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 25999669 - 25999710
Alignment:
| Q |
159 |
caaaatagagttttaagaagcagatgatggtggttgttgatt |
200 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
25999669 |
caaaatagagttttaagaagaagatgacggtggctgttgatt |
25999710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University