View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_high_39 (Length: 220)
Name: NF20194_high_39
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_high_39 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 35486385 - 35486590
Alignment:
| Q |
15 |
ctgtgtgtttataagtaagggattcaaaagtttcaggcttgtattgcgccaaggtataatccatgtcaaatcccacagcattaacgttcctcatattcag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35486385 |
ctgtgtgtttataagtaagggattcaaaagtttcaggcttgtattgcgccaaggtataatccatgtcaaatcccacagcattaacgttcctcatattcag |
35486484 |
T |
 |
| Q |
115 |
tggccggttacagaagatctgcttttttgtatcagttttagttttggcacttttgcagccaggagattccactgagatttcgttcattgaaaattatgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35486485 |
tggccggttacagaagatctgcttttttgtatcagttttagttttggcacttttgcagccaggagattccactgagatttcgttcattgaaaattatgaa |
35486584 |
T |
 |
| Q |
215 |
tgcacc |
220 |
Q |
| |
|
|||||| |
|
|
| T |
35486585 |
tgcacc |
35486590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 25 - 139
Target Start/End: Complemental strand, 6982366 - 6982252
Alignment:
| Q |
25 |
ataagtaagggattcaaaagtttcaggcttgtattgcgccaaggtataatccatgtcaaatcccacagcattaacgttcctcatattcagtggccggtta |
124 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||| || ||| ||||||||||||| || ||| |
|
|
| T |
6982366 |
ataagcaagggattcaaaagtttcaggcatgtattgtgccaaagtataatccatgtcaaatcccacagcaacaatattcttcatattcagtggtcgatta |
6982267 |
T |
 |
| Q |
125 |
cagaagatctgcttt |
139 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
6982266 |
cagaagatccgcttt |
6982252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 25 - 135
Target Start/End: Complemental strand, 52355320 - 52355210
Alignment:
| Q |
25 |
ataagtaagggattcaaaagtttcaggcttgtattgcgccaaggtataatccatgtcaaatcccacagcattaacgttcctcatattcagtggccggtta |
124 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| |||| ||||| ||||||||||||||||||||| || |||| |||||||||||| ||||||| |
|
|
| T |
52355320 |
ataagcaagggattcaaaagtttcgggcttgtattgtgccagagtatagtccatgtcaaatcccacagcaacaatgttcttcatattcagtgaccggtta |
52355221 |
T |
 |
| Q |
125 |
cagaagatctg |
135 |
Q |
| |
|
|| || ||||| |
|
|
| T |
52355220 |
caaaatatctg |
52355210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University