View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_low_20 (Length: 395)
Name: NF20194_low_20
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 16 - 380
Target Start/End: Complemental strand, 7666113 - 7665749
Alignment:
| Q |
16 |
atccatagtaacatcttcccatacctgagtgggtattggtagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666113 |
atccatagtaacatcttcccatacctgagtgggtattggcagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcaga |
7666014 |
T |
|
| Q |
116 |
cattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666013 |
cattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaa |
7665914 |
T |
|
| Q |
216 |
tcggtgaagcatgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttcttccagtataataagccttctttcactgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665913 |
tcggtgaagcatgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttcttccagtataataagccttctttcactgt |
7665814 |
T |
|
| Q |
316 |
gtagttactgtcagtgactgtattattgaggcattgttgtacaatagtttgtaagtgatcattct |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665813 |
gtagttactgtcagtgactgtattattgaggcattgttgtacaatagtttgtaagtgatcattct |
7665749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University