View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_low_36 (Length: 277)
Name: NF20194_low_36
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 81 - 261
Target Start/End: Complemental strand, 25624642 - 25624462
Alignment:
| Q |
81 |
gactaattattcacatttccaataatcggtttctccataaaatagttaacaattaagtgaatgtttaggtcaatgtttaccaaacatgcacgattgtaac |
180 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25624642 |
gactaatcattcacatttccaataatcggtttctccataaaatagttaacaattaagtgaatgtttaggtcaatgtttaccaaacatgcacgtttgtaac |
25624543 |
T |
 |
| Q |
181 |
agtgagtttagcaaaataactatgacaccatgattctattaaaactccttagtgtagcttttgctaaaagcactacggctc |
261 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25624542 |
ggtgagtttagcgaaataactatgacaccatgattctattaaaactccttagtgtagcttttgctaaaagcactacggctc |
25624462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 25624722 - 25624686
Alignment:
| Q |
1 |
caactgctgcttccaaccccatctggttagtcaatct |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25624722 |
caactgctgcttccaaccccatctggttagtcaatct |
25624686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University