View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20194_low_47 (Length: 238)
Name: NF20194_low_47
Description: NF20194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20194_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 39 - 220
Target Start/End: Original strand, 45403758 - 45403939
Alignment:
| Q |
39 |
ttcactcttatgaagtttagctagatatgagtccctaccctaccagtgcctcttgattatggttgccttcaactatccaccaaggtctgttagaatcagc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403758 |
ttcactcttatgaagtttagctagatatgagtccctaccctaccagtgcctcttgattatggttgccttcaactatccaccaaggtctgttagaatcagc |
45403857 |
T |
 |
| Q |
139 |
atgactgttactttcttcctcagtagcagcaggaagattaagatcaagaaagtccctaatctgtggaacttgttcctcaagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45403858 |
atgactgttactttcttcctcagtagcagcaggaagattaagatcaagaaagtccctaatctgtggaacttgttcctcaagt |
45403939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University