View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20195_high_12 (Length: 258)
Name: NF20195_high_12
Description: NF20195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20195_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 7 - 178
Target Start/End: Original strand, 51320365 - 51320528
Alignment:
| Q |
7 |
agatgatgaggtcgcactacaaaaatagacatcaaggttcctgtgaaatatatatatagaaatacatacatacataggttgggatgttgttaaacaaacg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51320365 |
agatgatgaggtcgcactacaaaaatagacatcaaggttcctgtgaaatatatagata----tac----atacataggttgggatgttgttaaacaaacg |
51320456 |
T |
 |
| Q |
107 |
taccgtcctcaggagctgatgagggaatagtaattgaattgggatttgacataattaaactctggtggtatc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51320457 |
taccgtcctcaggagctgatgagggaatagtaattgaattgggatttgacataattaaactctggtggtatc |
51320528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 51320553 - 51320609
Alignment:
| Q |
191 |
caatgaatctaaatgatggcccgttaagttatttgtacctaatgaatagtgtttctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51320553 |
caatgaatctaaatgatggcccgttaagttatttgtacctaatgaatagtgtttctt |
51320609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University