View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20195_high_7 (Length: 343)
Name: NF20195_high_7
Description: NF20195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20195_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 53665919 - 53665591
Alignment:
| Q |
1 |
gacaccctgcaatccttctagctttgtgctgcgagtctttcctctgcgccgcgagataggcagaactggagcactttcacagtcacatgagatttcaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
53665919 |
gacaccctgcaatccttctagcttcgtgctgcgagtctttcctctgcgccgcgagataggcagaactggaacactttcacagtcacatgcgatttcaagg |
53665820 |
T |
|
| Q |
101 |
tatatccaacaattatcatgctcagaaggatgcaaaaatgaggaatctataaatcacgcttttttggattgtgctttgcttggaagcatttggtattgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53665819 |
tatatccaacaattatcatgctcagaaggatgcaaaaatgaggaatctataaatcacgcttttttggattgtgctttgcttggaagcatttggtattgtg |
53665720 |
T |
|
| Q |
201 |
ttttgcactggttgggaattcatagtgttctctctaacggtgtggggatgtacgtgttacaattggtggctctcatttgtttagaaagaatattcgtaat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53665719 |
ttttgcactggttgggaattcatagtgttctctctaacggtgtggggctgtacgtgttacaattggtggctctcatttgtttagaaagaatattcgtaat |
53665620 |
T |
|
| Q |
301 |
tgatttcaattgatctggatgacttgtat |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53665619 |
tgatttcaattgatctggatgacttgtat |
53665591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University