View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20195_low_13 (Length: 260)
Name: NF20195_low_13
Description: NF20195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20195_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 19755694 - 19755466
Alignment:
| Q |
13 |
aagaaaatccagataatggtaacaatgtaattgatggagaagcagctgtgaagggccccataaagaaaaatcgagggcgtaaagaaggcaaacctgctag |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| |||| | ||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
19755694 |
aagaaaatctagataatggtaacaatgtaactgatggaaaagctgttgtgaagggccccataaagaaaaatcgagggcgtaaacaaggcaaacctagtag |
19755595 |
T |
 |
| Q |
113 |
tgcacattcatgcgttggagataatgcgtcgaaggtatctctacttaactttgagaattcccttaattttctttaacaaaccttctttattaacttcgac |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755594 |
tacacattcatgcgttggagataatgcgtcgaaggtatctctacttaactttgagaattcccttaattttctttaacaaaccttctttattaacttcgac |
19755495 |
T |
 |
| Q |
213 |
ttttttatgtgtttaagggtgctaaagtt |
241 |
Q |
| |
|
||||| |||||||| |||||||| ||||| |
|
|
| T |
19755494 |
tttttaatgtgtttcagggtgctgaagtt |
19755466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University