View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20197_high_31 (Length: 302)
Name: NF20197_high_31
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20197_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 28678324 - 28678052
Alignment:
| Q |
1 |
ctgttactcttgaatttcatttcagtgatttttataattcatatatattttttgttctgtttagcttattggatcatatgatttcctcaacatatacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678324 |
ctgttactcttgaatttcatttcagtgatttttataattcatatatattttttgttctgtttagcttattggatcatatgatttcctcaacatatacaat |
28678225 |
T |
 |
| Q |
101 |
ttttgtgttgttaaaggaggaaaaatgtttgtgaaatgaaaaattggaggttttagtttctgagttgttttgtgattttgcgtgtgacat---tgacagt |
197 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
28678224 |
ttttgtgttgttaaaggtggaaaaatgtatgtgaaatgaaaaattgggggttttagtttatgagttgttttgtgattttgcgtgtgacattgatgatagt |
28678125 |
T |
 |
| Q |
198 |
gataaacctctcaggttctcaatagcattaaatattgatttcaggtcaaaattaagtttccaacttcaatttct |
271 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678124 |
gataaaccactcaggttctcaatagca-taaatattgatttcaggtcaaaattaagtttccaacttcaatttct |
28678052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University