View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20197_high_40 (Length: 260)
Name: NF20197_high_40
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20197_high_40 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 123 - 260
Target Start/End: Original strand, 15593484 - 15593620
Alignment:
| Q |
123 |
tgctagtatattgggatttacaggctttgtagttgcttgaattggaaacttatagtctgccgcattgataggaaagttgattaatcaagacctatgtagc |
222 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| |||||||||||| |||||||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15593484 |
tgctagtaagttggaatttacaggctttgtagttacttgaattggaa-cttatagtctcccacattgataggaaagttgatgaatcaagacctatgtagc |
15593582 |
T |
 |
| Q |
223 |
actgacacgacacaaacacatgtgactacgttcaatta |
260 |
Q |
| |
|
||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
15593583 |
actgacacgacacaaacgcatgtgactatgttcgatta |
15593620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 59 - 115
Target Start/End: Original strand, 15593324 - 15593380
Alignment:
| Q |
59 |
ccctaatagaggaaaccaggatgagtgatggcaagtgacaacacttcattcttgctc |
115 |
Q |
| |
|
|||| ||||||||||||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15593324 |
ccctgatagaggaaaccacggtgagtgattgcaagtgacaacacttcattcttgctc |
15593380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 15593262 - 15593299
Alignment:
| Q |
1 |
tggaatggaactgatgaggatggtgtggtggcttgttc |
38 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
15593262 |
tggaatggaactaacgaggatggtgtggtggcttgttc |
15593299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University