View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20197_high_40 (Length: 260)

Name: NF20197_high_40
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20197_high_40
NF20197_high_40
[»] chr1 (3 HSPs)
chr1 (123-260)||(15593484-15593620)
chr1 (59-115)||(15593324-15593380)
chr1 (1-38)||(15593262-15593299)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 123 - 260
Target Start/End: Original strand, 15593484 - 15593620
Alignment:
123 tgctagtatattgggatttacaggctttgtagttgcttgaattggaaacttatagtctgccgcattgataggaaagttgattaatcaagacctatgtagc 222  Q
    ||||||||  |||| ||||||||||||||||||| |||||||||||| |||||||||| || ||||||||||||||||||| ||||||||||||||||||    
15593484 tgctagtaagttggaatttacaggctttgtagttacttgaattggaa-cttatagtctcccacattgataggaaagttgatgaatcaagacctatgtagc 15593582  T
223 actgacacgacacaaacacatgtgactacgttcaatta 260  Q
    ||||||||||||||||| |||||||||| |||| ||||    
15593583 actgacacgacacaaacgcatgtgactatgttcgatta 15593620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 59 - 115
Target Start/End: Original strand, 15593324 - 15593380
Alignment:
59 ccctaatagaggaaaccaggatgagtgatggcaagtgacaacacttcattcttgctc 115  Q
    |||| ||||||||||||| | |||||||| |||||||||||||||||||||||||||    
15593324 ccctgatagaggaaaccacggtgagtgattgcaagtgacaacacttcattcttgctc 15593380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 15593262 - 15593299
Alignment:
1 tggaatggaactgatgaggatggtgtggtggcttgttc 38  Q
    |||||||||||| | |||||||||||||||||||||||    
15593262 tggaatggaactaacgaggatggtgtggtggcttgttc 15593299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University