View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20197_high_56 (Length: 211)
Name: NF20197_high_56
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20197_high_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 7500608 - 7500802
Alignment:
| Q |
1 |
cagggaaagtggtgataatgtggctaacggttggatgcagaaggcaaggccacatggaggtgcaaatgttccgccataattcctcgttgttgcagatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500608 |
cagggaaagtggtgataatgtggctaacggttggatgcagaaggcaaggccacatggaggtgcaaatgttccgccataattcctcgttgttgcagatcaa |
7500707 |
T |
 |
| Q |
101 |
gtggcgaaggtcagaacatacacaggacaatgccattaaggctgccccatcgaggcgtggaaggatatagggctggatgatgtctggatctaacc |
195 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7500708 |
gtggcgaaggtcggaacatacacaggacaatgccattaaggctgccccatcgaggcgtggaaggatataggtctggatgatgtctggatctaacc |
7500802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 127
Target Start/End: Complemental strand, 27253177 - 27253110
Alignment:
| Q |
60 |
gtgcaaatgttccgccataattcctcgttgttgcagatcaagtggcgaaggtcagaacatacacagga |
127 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||| |||||| || || ||| |||||||||| |
|
|
| T |
27253177 |
gtgcatatgttccgccatagatcttcgttgttgcagatcatgtggcggagttctgaagatacacagga |
27253110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University