View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20197_low_45 (Length: 248)
Name: NF20197_low_45
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20197_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 25614009 - 25613790
Alignment:
| Q |
15 |
ggatggttttgaaaatattttctggtgcctcgtctatgctaagaaactcaacatttttaattgcatgaaagggaacatcatataaactgatatctgctct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25614009 |
ggatggttttgaaaatattttctggtgccacatgtatgctaagaaactcaacatttttaattgcatgaaagggaacatcatatgaactgatatctgctct |
25613910 |
T |
|
| Q |
115 |
gaccaacttggacaagggtttaaacccttccgctgcattgtcttctacaaatctcgtatattcacgacaaaaagtatgtaaatcttctagaactggacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25613909 |
gaccaacttggacaagggtttaaacccttccgctgcattgtcttctacaaatctcgtatattcacgaccaaaagtatgtaaatcttctagaactggacaa |
25613810 |
T |
|
| Q |
215 |
ccattaagaagtttcatgat |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25613809 |
ccattaagaagtttcatgat |
25613790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 17 - 171
Target Start/End: Complemental strand, 31262149 - 31261995
Alignment:
| Q |
17 |
atggttttgaaaatattttctggtgcctcgtctatgctaagaaactcaacatttttaattgcatgaaagggaacatcatataaactgatatctgctctga |
116 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||||| ||||||||||| ||| |||||||||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
31262149 |
atggttttgaaagtattttctggtgccactcttatgcaaagaaactcaagattattaattgcatcaaagggaacatcatatgaattgatatctgctctga |
31262050 |
T |
|
| Q |
117 |
ccaacttggacaagggtttaaacccttccgctgcattgtcttctacaaatctcgt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||| ||| |||||| |
|
|
| T |
31262049 |
ccaacttggacaagggtttaaacccttccgctgcattattttcttcaactctcgt |
31261995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 191 - 233
Target Start/End: Complemental strand, 31261993 - 31261951
Alignment:
| Q |
191 |
tgtaaatcttctagaactggacaaccattaagaagtttcatga |
233 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
31261993 |
tgtaaatcttctagaacaggacatccattaagaagtttcatga |
31261951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University