View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20197_low_53 (Length: 232)
Name: NF20197_low_53
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20197_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 1300406 - 1300611
Alignment:
| Q |
16 |
gtaatgtcacaaaaattaatgtaatctaaatttttgtattagtaatatatttcaccaaattatcatatcttgctgcagacgttggctgctgtgagtgaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1300406 |
gtaatgtcacaaaaattaatgtaatctaaatttttgtattagtaatatatttcaccaaattatcatatcttactgcagacgttggctgctgtgagtgaag |
1300505 |
T |
 |
| Q |
116 |
tgatgaaacaacagaaggggaaggataccaaaatcttgttgttgtctataggatgtggatctaaacaggttacagggtttaatgctgaagatgcaattca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1300506 |
tgatgaaacaacagaaggggaaggataccaaaatcttgttgttgtctataggatgtggatctaaacaggttacagggtttaatgctgaagatgcaattca |
1300605 |
T |
 |
| Q |
216 |
tctctc |
221 |
Q |
| |
|
| |||| |
|
|
| T |
1300606 |
tttctc |
1300611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University