View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20197_low_55 (Length: 226)
Name: NF20197_low_55
Description: NF20197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20197_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 52 - 196
Target Start/End: Complemental strand, 33620624 - 33620480
Alignment:
| Q |
52 |
acaactccaaagctgggaaagtatctgatagcttcgggtcaatttccggtgaatcaaacccaaacccaagttcaaaacaagcattgagttcctgcaagtc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33620624 |
acaactccaaagctgggaaagtatctgatagcttcgggtcaatttccggtgaatcaaacccaaacccaagttcaaaacaagcattgagttcctgcaggtc |
33620525 |
T |
 |
| Q |
152 |
atactccgagagactcttgcttaggcgaaggtgaccgtctctgct |
196 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33620524 |
atactccgatagactcttgcttaggcgaaggtgaccgtctctgct |
33620480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University