View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2019_low_4 (Length: 237)
Name: NF2019_low_4
Description: NF2019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2019_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 36163330 - 36163111
Alignment:
| Q |
3 |
cataaaagtacatagttaaatatagatttgttagcaataatagagtaaacagaagaaaaccgctaagtgcattaagtggcatgaaatctagaaggccaac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36163330 |
cataaaagtacatagttaaatatagatttgttagcaataatagagtaaacagaagaaaaccgctaagtacattaagtggcatgaaatctagaaggccaac |
36163231 |
T |
 |
| Q |
103 |
actttctcaaacttataatttagtgaatttcaactctcgcaaaggtcgaagtcataaaacaaaaattgttatgagaaaacaaataaatcaaagaaaattt |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36163230 |
actttctcaaacttataatttagtgcatttcaactctcgcaaaggtcgaagtcataaaacaaaaattgttatgagaaaacaaataaatcaaagaaaattt |
36163131 |
T |
 |
| Q |
203 |
ggatacgtatggagttacat |
222 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
36163130 |
ggatacgcatggagttacat |
36163111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University