View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20200_high_10 (Length: 203)

Name: NF20200_high_10
Description: NF20200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20200_high_10
NF20200_high_10
[»] chr1 (2 HSPs)
chr1 (18-184)||(3878568-3878734)
chr1 (18-184)||(3864561-3864727)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 3878568 - 3878734
Alignment:
18 gttttaacattaggaagaggacaaataggggatgcnnnnnnngttggtttacctgatttttccatgttgagagaattgtatatcgatgattctacacttg 117  Q
    |||||||||||||||||||||||||||||||||||       |||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||    
3878568 gttttaacattaggaagaggacaaataggggatgctttttttgttgttctacctgattgttccatgttgagagaattgtatatcgatgattctacacttg 3878667  T
118 gaaatagtattcaggagatatctgttgttcatgagagattgtgtcatcttgaattaataaaatgtcg 184  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3878668 gaaatagtattccggagatatctgttgttcatgagagattgtgtcatcttgaattaataaaatgtcg 3878734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 3864561 - 3864727
Alignment:
18 gttttaacattaggaagaggacaaataggggatgcnnnnnnngttggtttacctgatttttccatgttgagagaattgtatatcgatgattctacacttg 117  Q
    ||||||||||| ||||||||||| |||||||||||        ||| | ||||||||| | | ||||||||||||||| ||||| ||||||| |||||||    
3864561 gttttaacattgggaagaggacagataggggatgcattttttcttgctctacctgattgtactatgttgagagaattgcatatcaatgattcgacacttg 3864660  T
118 gaaatagtattcaggagatatctgttgttcatgagagattgtgtcatcttgaattaataaaatgtcg 184  Q
    ||||||||||||| ||||||||| | || ||||||||| |||||||||||||||||| |||||||||    
3864661 gaaatagtattcaagagatatctatcgtccatgagagactgtgtcatcttgaattaacaaaatgtcg 3864727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University