View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20200_high_3 (Length: 393)
Name: NF20200_high_3
Description: NF20200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20200_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 223 - 391
Target Start/End: Original strand, 45127541 - 45127708
Alignment:
| Q |
223 |
cgggcttaattaatggctcattagttcatagttttacaataaagggatggcttgagtggaaacaccaaaataatcttcaaagaattctccctcaaaaatt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127541 |
cgggcttaattaatggctcattagttcatagtta-acaataaagggatggcttgagtggaaacaccaaaataatcttcaaagaattctccctcaaaaatt |
45127639 |
T |
 |
| Q |
323 |
cttcaaagtattcattcattttggggacccaataattaagattagggttaaatagattcggtccctatg |
391 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127640 |
cttcaaagtattcattcattttagggacccaataattaagattagggttaaatagattcggtccctatg |
45127708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 45127031 - 45127157
Alignment:
| Q |
1 |
tatgctatgcatttgaggtcccataatggcaacgaatcaaccgtctctttctgattggaattgagcatgatatatactgtcccttcatttggacaacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127031 |
tatgctatgcatttgaggtcccataatggcaaggaatcaaccgtctctttctgattggaattgagcatgatatatactgtcccttcatttggacaacatt |
45127130 |
T |
 |
| Q |
101 |
gatgaagttcgttattatctaagctag |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45127131 |
gatgaagttcgttattatctaagctag |
45127157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University