View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20200_low_10 (Length: 253)
Name: NF20200_low_10
Description: NF20200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20200_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 244
Target Start/End: Complemental strand, 33169527 - 33169297
Alignment:
| Q |
15 |
atgaaaataagcggtgagactagttgataacatggctacccctgttaaaatatgagtggcctcatttatttgtcttcttttaaatcaaccttaaagtttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33169527 |
atgaaaataagcggtgagactagttgataacatggctacccctgttaaaatatgagtggcctcatttgtttgtcttcttttaaatcaaccttaaagtttg |
33169428 |
T |
|
| Q |
115 |
taaactgagcggcaaagaacttcctacaaattgtgataacataaccaagttctataacatcaatctgattcagt-aaggcatttgttggggttttgcaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33169427 |
taaactgagcggcaaagaacttcctacaaattgtgataacataaccaagttctataacatcaatctgattcagtgaaggcatttgttggggttttgcaat |
33169328 |
T |
|
| Q |
214 |
caagcacgaaatcaatattatcaaattgcat |
244 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |
|
|
| T |
33169327 |
caagcatgaaatcaacattatcaaattgcat |
33169297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University